I'm a css/html/js all that domain - beginner. so i am learning to code an app I added a white png to a code: <div class="todo-app"> <h2>To-Do list <img src="images/clock.png" alt=""></h2> <div class="row"> <input type="text" id="input-box" placeholder="Add your text"> <button>Add</button>…
Basically I wanted to change the color of input fields when using browsers autofill or saved emails (dropdown of previously used emails in the same input box). For that I was using these css properties. .form-control:-webkit-autofill, .form-control:-webkit-autofill:hover, .form-control:-webkit-autofill:focus, .form-control:-webkit-autofill:active {…
I have a table with fixed layout, it has two rows. In the first the width is working as they are 50%-45%-5%. In the second row I tried to set it to 30%-20%-50% but it does not work. I tried…
Hello All I am trying to move a4 to the area shown in the img but i cant find how or any related posts on how to get 2 divs to the right of the 1 div, Any and all…
I tried using background-image in css for the button background, but that only works for images and doesn't work for videos. So, are there any way to put a video as the background of the button? I'm trying to make…
I made a website using HTML and CSS which can be seen here. It works but as you can see, the image gallery has some spacing issues. the first space is bigger than the other ones As you can see,…
I have a to-do list project where i have a side bar that will slide in from the right. However, the side bar (cutomization-bar in the code) doesn't slide in the whole way so that there is some buttons that…
Right now only the first mp4 works with this, the second one doesnt. Honestly the stylesheet part is not that important, I don't mind if it gets cut out cause it's hard to do or something. I don't have the…
I have a number of sequences. Each sequence have a name and an array of characters. I have to order the characters vertical aligned: sequence1 AGCAGTAGACAGTAGTACGTACGATAGCTCGACTAGCA sequence2 GCGTAGCTCAGCTTCGATCCGATCGATATAAAGCTAGA sequence3 GCTTCGGAGCGGCTAGCTAGAGATAGCCGATCGATCGA If the character arrays becomes longer (or the visible space…
I would like to have two columns in bootstrap that both use a different container's max-width. The problem with absolute position in this case is that the container doesn't know what the height of the content would be. So that…