I have the following markup on my page: <h1 id="some-fragment"> <a href="#some-fragment" class="fragment-link"> <svg height="16" width="16" viewbox="0 0 24 24" fill="none" stroke="#000" stroke-width="2"> <path d="M15 7h3a5 5 0 0 1 5 5 5 5 0 0 1-5 5h-3m-6 0H6a5 5…
I have prepared a simple test web page at Github (using the main.css file) for my question: In a vertical flexbox layout I am trying to use ResizeObserver to watch a parent div element with flex-grow:1 and then keep the…
I'm trying to add a border between two row flex items, however whenever I add one, the flex items stay in top of eachother instead of being next to eachother, here is an example: This is how I want it…
so I'm making a neocities and I'm relatively new to HTML (but I'm picking it up quick), so I'm getting a lot of help from the internet lol. I've been grinding on it for about a week now. Right now,…
I am currently attempting to make a simple header with HTML and CSS. I have encountered a problem where my button list is not floating to the right, giving the site an odd appearance. I tried floating the list to…
I do Etch-a-Sketch - https://www.theodinproject.com/lessons/foundations-etch-a-sketch . But I want do something more than the assignment. I need do this ONLY with Flexbox and JavaScript (without CSS Grid) When I do gridContainer.style.height = "100vh" , it is a little bit more…
I'm trying to achieve the next design, where the elements take all the available space before breaking into a new line and also keeping the text centered: Right now I'm using these styles in the container: display: flex; justify-content: center;…
I have some articles in my code which has a display of grid. I have set the padding of the body to padding: 0 1em; and the min-width of the following elements and classes to 450px; can someone please tell…
I'm really sorry about this question, because I've already seen many similar questions on here, but I still can't figure it out. I'd like to create an overlay element with controls for a display element, where the controls are stacked…
I have a number of sequences. Each sequence have a name and an array of characters. I have to order the characters vertical aligned: sequence1 AGCAGTAGACAGTAGTACGTACGATAGCTCGACTAGCA sequence2 GCGTAGCTCAGCTTCGATCCGATCGATATAAAGCTAGA sequence3 GCTTCGGAGCGGCTAGCTAGAGATAGCCGATCGATCGA If the character arrays becomes longer (or the visible space…