I want to write a code for the following content in html. First sentence in one frame and remaining in another frame. Welcome to Steeloncall Your premier online marketplace for all things steel! We pride ourselves on offering a comprehensive…
I tried using background-image in css for the button background, but that only works for images and doesn't work for videos. So, are there any way to put a video as the background of the button? I'm trying to make…
I am scraping version information from a website. I am able to get the information, but unable to get it without formatting. Currently targeting the DIV tag with Id j_idt19. Is there a way to get the info from the…
Right now only the first mp4 works with this, the second one doesnt. Honestly the stylesheet part is not that important, I don't mind if it gets cut out cause it's hard to do or something. I don't have the…
import React, {useEffect, useState} from 'react' import axios from 'axios' import '../App.css' import { useNavigate } from 'react-router-dom' import { gettingData } from '../api/getUserData' import { handleLogout } from '../api/handleLogout' import { getGroundNear } from '../api/getGroundNearby' import { bookingSlot }…
I have a number of sequences. Each sequence have a name and an array of characters. I have to order the characters vertical aligned: sequence1 AGCAGTAGACAGTAGTACGTACGATAGCTCGACTAGCA sequence2 GCGTAGCTCAGCTTCGATCCGATCGATATAAAGCTAGA sequence3 GCTTCGGAGCGGCTAGCTAGAGATAGCCGATCGATCGA If the character arrays becomes longer (or the visible space…
I got a handlebars main template with the following code. <!doctype html> <html> <head> <title>Meadowlark Travel</title> </head> <body> <header><img src="/img/logo.png" alt="Meadowlark Travel Logo"></header> {{{body}}} </body> </html> and I have a directory structure like this. └── meadowlark.js └── img └── logo.png…
I would like to have two columns in bootstrap that both use a different container's max-width. The problem with absolute position in this case is that the container doesn't know what the height of the content would be. So that…
I want to create this template using grid: I am new to grid I don't know the properties and how to use it wisely to create this template I am worked on flex properties but I am not getting how…
I am curious if anyone can get 100% of these requirements working together, I can only get 80% (#4 is a pain): The header always stays at the top of the page. The footer always stays at the bottom of…